Comment énerver une Nounou ?

Aujourd’hui je suis de bonne humeur, donc je me sens d’attaque pour taper un super long post :3 sur toutes les choses qui m’énervent ¦D D’ailleurs, avant que je m’énerve je vais vous dire pourquoi je suis de bonne humeur ;3

Tout d’abord parce que je suis contente d’avoir reçu la bague que je voulais, qui est vraiment trop jolie, donc merci à la personne qui me l’a offerte <3, ensuite je suis enchantée de l’arrivée d’un nouveau membre dans ma famille de peluche (grâce à Noix de Cajou xD) : Pout Piout que voici :

Pout Piout

(qui est de la pâte de soja, malheureusement je ne connais pas son vrai nom, mais ce n’est que partie remise promis :3). Et pis, je ne suis plus trop déprimée car c’est bientôt ma rentrée (d’autres redoutent la leur, mais moi, je n’attends que ça lol car babai LEA ! Et bonjour snobs en école de commerce ¦D je rigole -à moitié- xD faut que je commence à vous regarder de haut d’ailleurs pour m’entrainer ¦D) et pis, et pis, c’était un chouette samedi avec les vieux (nom affectueux donné à Bakalex-Rose) et tout ça :3. Enfin bref, c’est cool quoi <3

Donc maintenant, passons aux choses sérieuses ! Qu’est ce qui énerve Nounouuu ? Première réponse : Trop de choses ¦D ! (Deux en fait, pour l’instant)

Let’s begin ~ (l’ordre n’ayant aucune importance <3) Je ne sais pas si vous connaissez la chanchon d’Anaïs « Mon coeur mon amour » mais ça fait quelque chose comme ça : « Je HAIIIIIS les couples qui me rapellent que je suis seule ! Je DETESTEEEEE les couples, je les HAIIIIS tout court ! » version Nounou ça ferait quelque chose comme ça : « Je HAIIISS les fumeurs qui me polluent les poumonnnnnsss ! Je DETESTEEEE les fumeuuuuuuurss , je les HAIIIIIIIIIS tout court ! » Bingo ! Une des choses qui m’énervent le plus ce sont les fumeurs égoistes ! Vous trouvez pas ça DINGUE ? Je trouve ça DINGUE, que les fumeurs pourrissent littéralement la vie des non fumeurs ! Où que j’aille, j’en vois. Je vous entends déjà : « Nion mais Nounou t’énerves pas, tu nous fais peur é.è, et pis et pis calme toi ! *chuchote à son acolyte* va me chercher ses calmants ¦D »

Mais, ce qui m’énerve le plus ce sont les fumeurs non CIVILISES, j’insiste sur ce point ! Ceux qui jettent leurs mégôts n’importe ou, N’IMPORTE OU je dis bien, ceux qui fument alors que nous sommes dans une gare un lieu PUBLIC, et alors, on atteint le summum quand ils fument alors qu’en fond sonore défile ce petit spot bien gentil-doudou : « Tum tum tum, nous vous rappelons qu’il est interdit de fumer dans l’enceinte de la gare Tum Tum tum ». Je veux dire, c’est si compliqué que ça de faire preuve d’un peu de civisme ? Bah, apparemment nion puisque d’autres fumeurs utilisent les cendriers prévus à cet effet, ou ne fument pas dans la gare. C’est comme quelqu’un qui se permettrait de fumer alors qu’il n’est pas chez lui, il ne ferait alors ni preuve de politesse ni de civisme.

Ce qui m’énerve encore plus (si si on peut m’énerver davantage ¦D), ce sont les fumeurs qui ne pensent qu’à eux. Pfff, c’est incroyable ça ! Genre tous ces acteurs, qui ont pété un cable juste parce que, désormais, il est interdit de fumer dans les restaurants (mesure qui, je l’espère, sera étendue à un maximum de lieux publics) et qui étaient révoltés  car on leur retirait une liberté gnagnagna. CERTES, c’est vrai mais ont-ils seulement pensé à toutes ces personnes qui avaient contracté un cancer grâce au tabagisme passif ? Se rendent-ils seulement compte à quel point c’est difficile pour un non-fumeur de trouver un endroit public où leurs poumons ne seront pas INTOXIQUES par les éléments toxiques contenus dans leurs cigarettes ? Ont-ils seulement réfléchi à NOTRE liberté à nous NON-FUMEUR qui consiste à vouloir manger, attendre le train, dans un air le moins pollué possible ? Je suis triste de voir que ça ne les choque pas plus que ça de voir des personnes mourir alors qu’elles n’ont pas fumé, ou encore qu’ils ne comprennent pas le besoin naturel de manger dans un endroit non fumeur !!

La seconde chose qui m’énerve n’est justement pas une chose, c’est une personne >:3. Cette dernière m’énerve incroyablement sur studyrama (un forum where i used to going ;3) parle d’une manière horrible, agaçante à souhait !! Le pire c’est qu’elle poste quasiment partout ;3 Jvous explique, elle désigne sa famille TOUJOURS par « le Père », « la Mère », « le Frangin ». Quand elle parle d’elle-même c’est TOUJOURS « Mouâ ». A force, ça saoule. J’ai toujours cru qu’il était impossible de détester quelqu’un à travers ses seuls posts mais il faut croire que si, c’est possible ¦D.

Sur ce, je vous laisse <3 c’est fatiguant de se plaindre !

Publié dans Et Moi... | 4 commentaires

17 Chiffre Magique <3 (pour les matheux, nombre magique xD)

Hihi ! Je voulais vous raconter ma journée du 15 septembre (cad hier) parce qu’elle a été vraiment bien :3

Alors en fait, Necrou et moi on devait manger chez Rose et Bakalex (car ils sont revenus de vacances et tout <3) pour le déjeuner, mais ils avaient une séance d’acupuncture qui ne finissait qu’à midi. Mais bon, ils sont pas (encore ;D) des supers heroes alors, forcément la téléportation ce n’est pas pour tout de suite ! C’est pourquoi ils devaient tel à Necrou pour savoir comment on allait faire. Quant à moi, pendant que Necrou dormait encore (nion, elle ne ronfle pas pour les curieux ¦D) je me suis préparée pour aller voir ma copine (que nous nommerons point, de peur qu’elle ne soit harcelée par des paparazzis ¦D) afin d’aller à Gibert Vieux (et non Jeune haha ¦D) ou à Gibert Joseph en sérieuses (jeunes, belles et drôles, riches) étudiantes que nous sommes ! C’était bien sympa, et j’ai grignoté un petit Mcdo avant de manger mon déjeuner chez Baka-Rose (et nion un Bac à Roses ¦D) -à la Bennifer xD- ¦D.

Malheureusement il y a eu des problèmes sur le rer B (ya pas mal de problèmes sur les différentes lignes en ce moment, vous trouvez pas ? o.o;) donc en dignes semi Parisiennes que nous sommes Necrou et moi on a fait un détour pour arriver à bon port >:3. Chez BakaRose on a joué à la Wii (cadeau d’anniversaire de Bakalex <3), et on s’est ouvert l’esprit grâce à nos différentes lectures (Cosmo et Télé Star ¦D). Nous sommes parties découvrir le tout nouveau centre commercial à Thiais (Thiais village :3) qui est très sympa :3, en plein air (quand il fait beau comme hier c’est génial *0*/) et il y a vraiment des boutiques qui valent le détour =3. On a acheté des bandeaux trop jolis (je suis sûre que ça nous va ¦D), et un bouquin ^^ (nion Télé Star n’est pas un bouquin ¦D).

Rose nous a raccompagné chez nous (en voiture attention ! poule de luxe que nous sommes ¦D) et et elle a mangé « bhong thang » (bouillon de soupe avec vermicelles de riz, et tout plein de choses trop bonnes en garniture *0*/) avec nous le soir :3 ! En clair, une superbe bonne journée <3

Publié dans Et Moi... | 2 commentaires

Chose promise, chose dûe. :3

Je vous avais promis mon aventure avec un célèbre fournisseur français d’accès à internet haut débit que l’on nommera Frii -notez l’inspiration de la Wii >;3-, chose promise, chose dûe !!

Il y a fort fort lointain, la famille de Nounette décida de souscrire aux services de Frii (c’était sans se douter de ce qui nous attendait ! ) afin de profiter pleinement du téléphone (comptant deux pipelettes dans la famille, l’offre ne pouvait être que très rapidemment rentabilisée ¦D). Les paperasseries finies, la boîte reçue et installée commença l’ère des Ennuis.

Les premiers jours (voire même seulement les 2 premiers jours ¦D) tout marchait comme sur des roulettes (ou Rouglor -le chat que j’ai mis lors de l’ouverture du site ¦D-) puis.. petit à petit… insidieusement (pas comme les rats parce que j’ai vu Ratatouille et tout mais ça ne fait pas de moi une adoratrice de rats nion plus o.o;) troubles began… *Hou HOU hOu HoU (musique de paranormal pour faire peur et tout)*

D’abord o_o il a fallu faire des hard reboot (pour les novices, il s’agit -pour Frii ¦D- de la solution miracle, c’est-à-dire qu’il faut rédébrancher 5 (oui le chiffre 5 a son importance ¦D) fois la prise) pour pouvoir composer des numéros. Si ce n’était que ça… Au fil du temps, les conditions pour émettre un appel se dégradèrent rapidemment, à chaque fois que nous composions un appel nous entendions au choix : « votre numéro d’incatif est erronée, vous ne pouvez passer votre appel », ou encore « votre appel ne peut aboutir, veuillez réessayer ultérieurement » toujours servis par la même voix (d’ailleurs, si jamais j’apprends à qui appartient cette voix ¦D). Et on avait beau débrancher 17 fois par jour ça ne changeait rien é.è

Comme si cela ne suffisait pas, désormais, recevoir un appel nous était quasiment impossible à cause du bruit de mitraillette que s’est mis à faire notre téléphone O.O; du genre COUCHEZ VOUS PAR TERRE !!! ON NOUS ATTAQUUEEE !!! *TUC TUC TUC TUC TUC TUC (et nion je ne fais pas de la pub pour un célèbre biscuit xD)* J’AI DIT TOUT LE MONDE A TERREEE !!! Enfin, je m’égare la ¦D Donc, difficile avec ce bruit de pouvoir tranquillement papoter ! Nous avons donc décidé de changer notre téléphone pensant que c’était ce dernier la cause de tous nos malheurs.

Fatale erreur !! Par la suite, nous avons découvert que ce dernier n’était nullement en cause puisqu’en changeant d’appareil le bruit avait quant à lui entamé son évolution (tel un Pokémon ¦D) passant d’un bruit mitraillette à un bruit zarbi o.O du genre TACTACTACTACTACTACTACTAC (si vous voulez je m’enregistre et je vous mets comment c’était XD).

Nous avons bien entendu multiplier les appels (surtaxés ¦D) à Frii afin de régler le problème -qui ne nous le cachons pas, commençait sérieusement à nous déprimer !-. Et ça donnait quelque chose comme ça :

Nounette : Al*TUC TUC TUC TUC TUC TUC*lo *TUC TUC TUC TUC TUC TUC* ?

Frii : Al*TUC TUC TUC TUC TUC TUC*lo? Bon*TUC TUC TUC TUC TUC TUC*jour, veuillez me donner votre *TUC TUC TUC TUC TUC TUC* nom, numéro de portable,*TUC TUC TUC TUC TUC TUC* et adresse mail s’il vous *TUC TUC TUC TUC TUC TUC* plait.

Nounette : *récitant d’une traite* *TUC TUC TUC TUC TUC TUC* Bon*TUC TUC TUC TUC TUC TUC*jour, mon nom « Blablablou »*TUC TUC TUC TUC TUC TUC* mon numéro « ah beuhleuleuleu*TUC TUC TUC TUC TUC TUC*leuleuelue », mon adresse « amounounounounounounou*TUC TUC TUC TUC TUC TUC* » oui je vous appelle pour ce *TUC TUC TUC TUC TUC TUC* bruit comme vous pouvez l’entendre, je vous ai déjà appelé un milliard de fois *TUC TUC TUC TUC TUC TUC*

Frii : Ou oui *TUC TUC TUC TUC TUC TUC* je vérifie votre dossier, vous *TUC TUC TUC TUC TUC TUC* avez déjà procédé à un hard reboot ? *TUC TUC TUC TUC TUC TUC*

Nounette : ouiiii *TUC TUC TUC TUC TUC TUC* et tous les fils sont biens bracnhés tout va bien *TUC TUC TUC TUC TUC TUC* donc peut on changer notre friibox ? *TUC TUC TUC TUC TUC TUC*

Frii : Non madame je suis désoléee *TUC TUC TUC TUC TUC TUC* il faut d’a*TUC TUC TUC TUC TUC TUC*bord voir s’il n’y a pas un problème avec la ligne avant de pouvoir chnager de friibox*TUC TUC TUC TUC TUC TUC* vous coprenez madame ? *TUC TUC TUC TUC TUC TUC* Nous procédons actuellement à une remontée de *TUC TUC TUC TUC TUC TUC*ligne *TUC TUC TUC TUC TUC TUC*.

Nounette : *de plus en plus déprimée* et*TUC TUC TUC TUC TUC TUC* com*TUC TUC TUC TUC TUC TUC*bien de temps cela va prendre ?*TUC TUC TUC TUC TUC TUC*

Frii : Eh bien c’est *TUC TUC TUC TUC TUC TUC* difficile à *TUC TUC TUC TUC TUC TUC* dire mais *TUC TUC TUC TUC TUC TUC* vous devez juste patienter.

Nounette : *énervée* Mais ça fait *TUC TUC TUC TUC TUC TUC* plusieurs mois que nous *TUC TUC TUC TUC TUC TUC* patientonnnnns !!!!!!!!!! è__________é//

Frii : oui je sais bien *TUC TUC TUC TUC TUC TUC* madame mais il ya t-il autre chose *TUC TUC TUC TUC TUC TUC* que je puisse faire pour vous ?

Nounette : *TUC TUC TUC TUC TUC TUC* Mouais nan. *TUC TUC TUC TUC TUC TUC* mais bonne journée *TUC TUC TUC TUC TUC TUC*

Frii : *TUC TUC TUC TUC TUC TUC* Frii vous souhaite une *TUC TUC TUC TUC TUC TUC* bonne journée aussi madame.

Tuuuut… Tuuuut… Tuuuut… Tuuuut…

J’imagine que cela a été très chiant de lire avec tous ces *TUC TUC TUC TUC TUC TUC* mais imaginez comment ça doit être d’écouter (ou même de les copier coller tous ces *TUC TUC TUC TUC TUC TUC* ¦D ) mais depuis on a changé la boîte et ça va vraiment mieux *0*/ on revit, on ne vit plus sous la peur des … des bruits que je n’ose vous refaire de peur d’offenser à nouveau le Dieu Frii é.è >;3 N’empêche, j’ai toujours peur que notre téléphone redéglingue c’est pourquoi je ne vais pas trop cracher mon venin sur Frii >:3 Moi , superstitieuse ? Nan mais ça va pas oui ! *s’agenouille pour poser des offrandes sur l’autel du Dieu Frii* >;3

A très vite mes chous ¦D

Publié dans Et Moi... | 7 commentaires

Toum Toum TOUMMMMM !!! O.O

Mouhouhouhou !! Bonjouuuuuuuuuuurr tout le monde !! O.O

Je voulais vous parler de l’anniversaire de Rose pour ses bip bip ans il y a superrrr longtemmppppsss !! (26 août pour les personnes qui n’ont pas encore envoyé leurs cadeaux d’anniversaire ¦D) Désolééé pour le retard é.è, mais comme j’ai mis les photos sur le pici j’ai retrouvé -non pas le goût de vivre quand même ¦D-, mais l’envie de vous parler, à vous mes fans !! O.O

Alors euh, bah, l’anniversaire de Rose on l’a fêté dans un resto asiatique à Paris 13ème (les serveurs n’étaient pas en forme ce jour là lol on a attendu super longtemps avant d’avoir un couteau -sale qui plus est xD;;;- pour le gâteau. Oh my, la super pub que je leur fais xD mais les plats chauds et tout sont trop bons *-*) et et donc jvous montre la photo du gâteau <3

Le gâteau de Rose <3 Il a l’aiiir bon nion?o.o Vous avez droit de dire nion hein xD

Et sinon et sinon c’était rigolo parce que qui dit anniversaire, dit cadeaux (oui je suis vénale et matérialiste et alors ? [Le petit chat d'Agnès est mort. Et Alors ? Quelle triste fin, quel triste sort. Et alors? O.O pour les gens n'ayant pas compris je vous invite à écouter la chanson de Mélissa Mars "Et Alors" ;3]) Aloooors Bakalex nous a fait beaucoup rigolé en nous refaisant la scène où il a offert son cadeau à Rose :

Bakalex : Tadaaaa ma puuuuuceee bon anniversaiiiiiiiire !!! *tends une coque en plastique à Rose*

Rose : *la mine quelque peu déconfite -je pense ?- Hon Merci.

Bakalex : *content* Tu me demandes pas ce que c’est ?

Rose : *l’air tout zombi xD* C’est quoi ?

Bakalex : *ravi* C’est une coque en plastique.

Rose : Ah.

Bakalex : Tu me demandes pas ce que ça protège ?

Rose : ça protège quoi ?

Bakalex *tout chou tellement il a l’air content <3* çaaaaaaaaaaaaaaa !!! Tadaaaaaaaaaaaaaaa *tends un lecteur mp3 tout high tech avec écran tactile et tout*

Rose : Mais j’en ai déjà un (elle fait référence à son portable)

…XDDDDDD… mais le cadeau que lui a offert Bakalex peut lire des vidéos et tout et il est tout high tech (et Rose est contente de son cadeau promis ! <:3)

Quant à Necrou et moi, nous avons fait les magasins l’avant-veille de son anniversaire (ouais, même pas peur de ne rien trouver et de se pointer au resto avec que dalle xD lol) et et alors, moi, j’ai trouvé un mug rouge-bordeaux avec écrit « Gout thé » (et nion goûter XD haha) et une cuillère pouvait être glissée dans la poignée ^^. Necrou quant à elle, a trouvé un super bon pull jacquard chez Esprit (cher XD lol) rouge, blanc avec des fils argentés. Nous avons aussi acheté une paire de boucle d’oreille serpent en argent avec améthyste. C’était sans compter sur l’épreuve qui nous attendait demain : Rose voulait faire du shopping (pour ne pas penser au boulot >:3). Malheureusement (ou heureusement xD) elle a repéré toutes les choses qu’on lui avait acheté et elle voulait se les acheter ¦D. Par chance à Esprit il n’y avait plus sa taille xD mais tenace est Rose, elle a voulu aller au Esprit près de chez elle et tout, Necrou a donc dû recourir à de multiples stratèges pour l’empêcher de commettre l’irréparable !! O.O

Donc au final, Rose a beaucoup aimé ses cadeaux (son préféré étant bien entendu le mug <3) et c’était rigolo ^^.

A très vite pour de nouvelles aventures !!

Publié dans Et Moi... | 5 commentaires

This is not over !

Mouahahahahaha !!! Vous avez vraiment cru que…. j’allais laisser mon honneur trainer ainsi dans la boueee ? (Sans vexer tous les fans de Christophe Maé ¦D) Je tiens donc à préciser que je n’aime pas vraiment Christophe Maé (c’est juste qu’à force de l’écouter, ça en devient écoutable ¦D) et aussi qu’il est inutile de m’offrir son album (je dis ça à tous mes fans qui souhaitent me faire plaisir ¦D achetez moi plutôt des trucs de papeterie que je vous aurai communiqué via ma wish list :D).

Comme le proverbe le dit si bien >:3 la venchange étain plat qui se manche frouad ! (il fallait comprendre la vengeance est un plat qui se mange froid pour les nullos qui n’ont pas compris ¦D) c’est pourquoi… savez vous que Necrou *réfléchis* bah Necrou elle elle elle … aime bien Britney Spears !! (Enfin ce qu’elle faisait comme musique avant, et moi aussi en fait houhou ¦D)

Enfin bref u.u je crois qu’il est temps d’arrêter tout ce petit cinéma… Il est clair que Necrou m’a plus tapé la honte vu que de nombreux fans (enfin c’est une expression hein ¦D) ont demandé à Necrou si c’était vrai que j’aimais Chris T_T mouhouhou mon honneur n’est plus ce qu’il était ! (Je devrais peut-être engager une procédure judicaire pour atteinte à mon honneur ¦D).

Sur ce, je préfère prendre les devants en vous annonçant officiellement que la vague Hairspray m’a elle aussi contaminée puisque non seulement j’ai pour avatar et pour fond d’écran dans mon téléphone portable :

And I’m …Link !!! <3 !!! Oh my Goddddddddd !! Liiiiiiiiink !! Le premier qui me fait le lien avec Zelda jle décapite xD

ps : Avant que Necrou ne balance cela, je préfère vous prévenir moi même que je vais peut-être regarder High School Musical !!! xD Si Si c’est vraiii XD et je n’ai pas honte ¦D

Publié dans Et Moi... | 4 commentaires

Nounou contre-attaque ! >:]

Mouhahahaha !! Bonjour tout le monde ! =D

Alors voilàa, pour rétablir mon honneur je me vois dans l’obligation de révéler quelques secrets ebils sur Necrou ! niark niark niark ! Certes, ce qu’elle a dit est bel et bien véridique é.è (mais ne me jugez paaaasss s’il vous plait é.è), certes elle a gommé des détails concernant mes lectures glauques (comme le fait qu’à une époque elle me voyait sangloter et me tendait immédiatement la boîte de mouchoirs <3 accompagné d’un « Honn mais GniouGniou pourquoi tu lis ça pour être toute tristounette après ? T_T ») il n’en reste pas moins qu’elle a tenté de vous faire peur à vous mes fans è__é// dans le but secret (j’en suis sure krkrkrkr) de me ravir mes précieux 5 fans ¦D elle est jalouseeee !!! O.O

Qu’importe ! Est ce que vous serez toujours aussi fan de Necrou si…. elle …. *suspense* écoutait Bric-à-brac de Priscilla ? *tintintin (et milou houhou xD)* O.O humm… Vous êtes coriaces vous >:3 et si je vous disais que Necrou…. faisait des stats en vacances pour s’avancer ? *tintintin* O.O Nion toujours pas ? je vois que vous êtes partisans des hard-worker ;3 houhou

Aux grands maux (mots haha xD) les grands remèdes !! Elle n’aime pas le chocola Milka !!! Si si jvous jure (enfin elle est pas une Chocolatholic [étrangement j'ai l'impression de lire Catholic o.O]) ! Au vu de vos regards horrifiés, je sais que ma mission est accomplie, pour l’embêter encore plus tiens, je vais mettre une .. photo d’elle !!!! *tintintin* O.O

Nan mais vous avez pris vos rêves pour la réalité ou quoi? O.o XD mouhahahaha >:3 Cette Nounou alors toujours aussi machiavélique ! ¦D

Publié dans Et Moi... | 2 commentaires

26 Août et tout~

Maw !

Je sais pas comment le site marche chez vous mais chez moi c’est décalé xD donc donc dites moi comment ça fait chez vous houhou xD Petit post spécialement dédié à Rose pour lui souhaiter un bon anniversaire :3 (bonianiverchaireuh rooosee !! Voila c’est fait :D houhou) et j’en profite pour vous faire remarquer que le site est encore un peu en chantier ¦D mais c’est on ne peut plus normal hein ! ¦D

A bientot pour vous raconter la journée d’hier qui fut très plaisante <3

Bonne journééééééé <3 !!

phrase du moment : Nan, mais t’as cassé mon système (en parlant aussi bien du étendage de linge, ou d’un jeu, en bref, de n’importe quoi ¦D)

pensée du moment : Ce qu’on ignore ne peut nous manquer :3 Thx Necrou ¦D

Publié dans Et Moi... | 3 commentaires

Mes chaussures et ma bouilloire :3~

Bonjour ! =3

Alors c’est officiel, mon pc n’est plus malade !! \o\ Ce qui sous-entend bien évidemment, que je n’aurai plus d’excuses pour ne pas mettre à jour >;3 huhu <3 et puis mes parents sont revenus de leur voyage youhouuu \o\ /o/ \o/ !! Leur retour signifiant aussi celui des bons petits repas *0*/ (certes certes, ce que nous faisions Necrou et Moi n’était pas Beurk (>;3) hein) mais bon, ça fait toujours plaisir de savoir qu’ils sont de retour (pour nous jouer des mauvais tours ;3).

Sinion ! O.O je voulais vous parler de deux paires de chaussures dont j’ai récemment fait l’acquisition *-* ¦D La grosse patapouf Rip Curl et une paire de basket Adidas rose (je suis dans ma période rose là *-*)

Donc en fait c’était euh… (oh my god XD) le 9 Aôut ¦D et et Grande grande soeur avait proposé que ce soit ma journée spécial shopping afin de trouver mes chauchures et le sac (un sac Lancaster d’une ancienne collection que j’ai vu sur une fille ¦D). Donc on est allées à Stock André (station Gobelins) parce que j’y avais déjà réperé la fameuse paire de baskets rose (et que les prix y sont vraiment intéressants !). On y va, j’essaye les chaussures et là, je craque à la première seconde *_* mais j’aurai bien aimé essayé la même paire en 41 (parce que j’ai essayé en 40 1/3 c’est précis lol XD) donc je demande à la (méchante) dame et elle me dit qu’il y en a pas. Mes soeurs ayant peur pour mes (pas si) petits pieds me disent qu’il vaut mieux être à l’aise dans ses baskets, parce que ce sont les chaussures de tous les jours et tout. Donc on s’en va, même si je suis toute triste de dire babai à mes chaussures. Une fois arrivées chez Grande grande soeur, je me dis que la paire de pointure 40 1/3 était pas si serrée en fait T__T puisque je pouvais bouger mes doigts de pied et tout~.

Réalisant ma terrible erreur j’avoue à mes soeurs que je n’ai qu’une envie : repartir et les acheter !! ¦D Necrou étant moyennement pour, et Grande grande soeur un peu plus mais pas des masses non plus XD nous repartîmes tout de même (moi en tête XD) et nous arrivâmes pour la seconde fois de la journée devant le magasin. Necrou ne veut point y entrer, et Grande grande soeur reste donc avec elle devant le magasin :3. Je m’envole vers mes baskets, les réessaye et file vers la caisse le coeur léger <3. La mine radieuse (ce qui n’est apparemment pas le cas des gens qui y travaillent houhou ¦D) je paie et cours rejoindre mes soeurs, mon précieux achat dans mes mains. J’étais trop contente hihihihihihihihihihi voire même hystérique houhouhouhou ¦D.

Quant aux autres chaussures, ce fut bien plus facile puisque je les avais déjà essayées la veille (si je me souviens bien ¦D) et et donc je les ai juste achetées ^^.

Quant à la bouilloire ! Je voulais vous faire partager la nouvelle venue dans notre cuisine (la dernière bouilloire ayant rendu l’âme T_T) je la trouve craquante hihi ^^

Sans plus tarder voici les photos ! *-* Dans l’ordre : les Adidas Rose, les Rip Curl, une photo de famille et enfin la bouilloire !

Adidas Rose Adidas Rose’

Rip curl Photo de famille

Bouilloire mimie ! Bouilloire mimie tape 2 !

Voilaaa ! Sur ce, je vous laisse tranquille <3

Publié dans Et Moi... | 7 commentaires

Le Code ! °0°//

photo-012.jpg

Coucou tout le monde <3 !!

Comme vous avez pu le constater en cliquant sur l’image, j’ai fait ce jour-là, exactement 25 fautes. Pour ma défense, il s’agissait de ma première fois (sans même avoir révisé le code !). Aujourd’hui après environ un mois je suis passé à 11 fautes (signe du destin je publie un 11 Août houhou xD;;). Plutôt stable (enfin ça fait juste trois jours que j’enchaîne le 11 fautes), mon but ultime est d’atteindre le palier rêvé des 5 fautes *0*//.

Necrou m’a dit qu’elle avait l’impression que l’on progressait semaine par semaine, je pense qu’elle a raison nous devenons chaque semaine plus fortes ! Plus fortes afin de vaincre des questions non seulement tordues, vicieuses, maléfiques quoi. Non mais vraiment, est ce que je voyais cet abruti de piéton qui était engagé sur la voie piétonne ? Nion pardi ! Bon okay dans ce cas là c’était bel et bien de ma faute (le piéton était au premier plan mais je ne sais comment j’ai fait je ne l’ai pas vu XD;;) Pourtant, il y a des circonstances où je dégage toute responsabilité ! Du genre, si l’on refuse de se soumettre à un test d’alcoolémie que risquons-nous ? Eh bien, tout comme vous (si vous êtes des êtres normaux¦D no offense) je ne sais paaaas¦D. Enfin, passons, et puis au code il y a des maths aussi ! Par exemple pour calculer la distance de freinage (corrigez moi si je me trompe :3) ! Du genre, j’ai appris que si vous rouliez à 50km/h alors la distance de freinge correspond au chiffre des dizaines de la vitesse à laquelle vous roulez (en l’occurrence 5 dans mon exemple) multiplié par ce meme chiffre (toujours 5 donc) ce qui fait 25 d’après la calculatrice ! On peut donc dire que la distance de freinage si nous roulâmes à 50km/h équivaut environ à 25 m. Et je peux même vous le faire sur un sol mouillé ! Et viiii sol mouillé, sol sec, ça change tout ! ¦D

Sinon, moi je comprends pas les carrefour à sens giratoire, enfin il y avait une question qui était tellement bizarre que je ne l’ai pas comprise, et malheureusement il y en a tant d’autres ! Parfois je réfléchis plus pour essayer de comprendre la question que pour trouver la réponse (si si votre déesse est faillible ¦D) ! Mais bon, je pense que plus j’irai et plus vite je progresserai, mais bon, j’ai aussi remarqué que plus j’y allais et plus je réfléchissais sur le sens des questions o.o.(o) haha (vous avez vu mon smiley ¦D)

Bref !! Et puis… Comble de l’horreur Necrou m’a judicieusement fait comprendre que mon cerveau se vidait au fur et à mesure ¦D. Je m’explique, au fil du temps je suis devenue implacable sur les questions concernant les feux, mais, depuis quelques temps, je suis plutôt devenue implacable sur les questions de stationnement (pas comme une certaine personne ¦D bwahabwah) et (malheureusement) je suis devenue placable sur mon sujet de prédilection snif T_T d’où « mon cerveau se vide au fur et à mesure » !! Mais ça va aller je vais essayer de colmater cette fissure¦D.

Sur ce je vous laisse je dois aller au code (nion je rigole xD;;). Courage nous ! \o/ et vous aussi pauvres petits mortels, euhm euhm je veux dire mes fans adorés ¦D.

ps : j’ai acheté mes chaussures (une paire baskets [rose xD je suis dans ma période rose là] et une euh grosses patapouf du genre : ) Faudra que je vous raconte parce que c’était rigolo houhou ¦D

Publié dans Et Moi... | 3 commentaires

Moi est une fille

pinkrosesfromjason.jpg

Pour bien des personnes, une fille se doit d’être élégante, brillante et dotée de toutes les qualités du monde. Toutefois, j’entends les mauvaises langues -mais j’entends aussi les bonnes langues- qui me diront aussi que les filles n’ont aucun sens de l’orientation, qu’elles se mettent toujours du mascara la bouche ouverte, ou encore qu’elles sont de mauvaise humeur quand elles ont leurs règles… Sommes-nous toutes des accros du shopping ? Est-il vrai que nous sommes vénales ou matérialistes ? Et bien attention mesdames et messieurs (dans un instant…), mais je pense surtout à ces messieurs, ouvrez grand vos yeux car il va sérieusement falloir rattraper vos lacunes concernant les filles…

A mon grand regret, ma meilleure amie dirait que je suis l’exemple même de la fille nulle en orientation et je dois avouer qu’elle a raison. En effet, rien que pour vous donner un aperçu du désastre laissez moi vous raconter ce qui m’est réellement arrivé : ma meilleure amie est scolarisée dans un lycée d’une ville voisine, je devais donc passer la chercher pour que nous puissions déjeuner ensemble, et ne sachant point où se trouvait son lycée, elle tenta (vainement ?) de m’expliquer où se trouvait celui-ci par des indications (peu précises à ma défense) telles que « prends à droite après les deux magasins d’alimentation asiatique » ou encore « tu vas tout droit et tu verras un lac et une église ».

J’ai tant bien que mal essayé de la rassurer tout en sachant pertinemment que non seulement j’allais bel et bien me perdre mais aussi qu’elle en était parfaitement consciente. Le jour J, j’ai essayé de suivre à la lettre ces indications mais, malheureusement je vois bien que je ne fais pas le poids : je ne fais que m’enfoncer de plus en plus dans cette jungle qu’est sa ville.

Je prends donc mon courage à deux mains et ose demander mon chemin à une inconnue, qui m’explique de manière précise et brève comment parvenir à mon but. Je hoche la tête de manière convaincue « oui oui j’ai compris merci » pour me retrouver deux minutes plus tard en train de mendier mon chemin à une autre dame.

Là encore, rebelote, « oui oui j’ai compris merci » pour me retrouver face à un carrefour perplexe. Voyant que la dame n’est pas très loin j’entreprends de lui faire des signes de la main afin qu’elle m’indique la direction à prendre. Imaginez-vous mon étonnement quand je la vois parler à un garçon d’environ 17 ans -en me montrant du doigt-, qui s’approche vers moi me demandant de le suivre puisque nous nous dirigions vers la même destination, s’en est donc suivit une marche d’environ 10 minutes côte à côte dans un silence de mort.

C’est donc grâce à ces 3 personnes que j’ai réussi à trouver son lycée mais ma meilleure amie, avait pensé à tout : accroître la difficulté en me proposant un défi de taille : l’attendre devant sa salle de cours. Comme vous vous en doutiez, mon honneur étant en jeu, je n’ai pu refuser et c’est donc comme cela que je me suis retrouvée à déambuler dans son lycée, épiant chaque côté à la recherche d’indices. Mais c’est sans suspens que je vous annonce mon éblouissante réussite à travers ces nombreux obstacles. Passons maintenant au point suivant.

A mon humble avis, seul un garçon peut croire que toutes les filles sans exception, sont accros au shopping mais est-ce seulement vrai ? Sommes nous toutes des dingues du shopping ? Je ne peux nier, dans mon cas, cette évidence : oui j’adore le shopping ! Mais ne suis-je pas un cas particulier ? Après tout, vous connaissez beaucoup de gens, vous, qui attendent au moins une semaine avant de retirer l’emballage d’un objet ? En effet, j’ai acheté récemment un vernis à ongles bleu clair que je trouve absolument ravissant. Malgré tout, j’ai comme une sorte de rituel qui consiste à attendre au moins une semaine ou deux avant de l’utiliser. Mais que puis-je donc bien faire avec me direz vous ! Eh bien, je le laisse poser sur ma table paisiblement et l’admire en passant…

Bien souvent on reproche aux filles de devenir complètement folle lorsqu’il s’agit de shopping mais je rétorquerai à ces mauvaises langues qu’au contraire, le shopping peut nous responsabiliser ! En effet, suivez mon raisonnement, si l’on veut acheter un bien il nous faut de l’argent, or celui-ci ne tombe pas encore du ciel (vous remarquerez mon optimisme avec le encore) par conséquent nous sommes dans l’obligation de gagner de l’argent et/ou d’économiser ! Je vous avoue, que mon objectif est bien sûr d’avoir un métier intéressant etc… Mais aussi (et surtout) un travail plutôt bien payé afin d’assouvir mes fantasmes shoppiniens les plus fous (si si je vous assure ce pantalon n’arrêtait pas de me fixer et de m’appeler !). Mais pouvons nous jusqu’à dire que nous sommes toutes vénales ? Toute la question est là ! Par exemple, serions nous prêtes à fréquenter quelqu’un juste pour la somme étourdissante qu’il possède dans son compte en banque ? Que répondre à cela ? Si ce n’est que je lance ici un appel, si toi, lecteur, tu es jeune (mais pas trop), séduisant, intelligent et drôle n’hésite pas à m’appeler au 0617****** !! Ah j’ai failli oublier ! Les candidats anglais, ou américains étant riches et beaux (cela va de soi pardi !) seront sans nul doute avantagés, sur ce, je vous laisse décrocher votre téléphone.

Publié dans Moi et... | 3 commentaires